Primer binding tool

This tool will help you to identify primers that bind to a DNA fragment of interest. In contrast to many other available tools, this one will also identify primers that only partially bind (e.g. when restriction sites are added to the 5’ of the primer). If you encounter any problems please contact me, so I can improve this tool. For more information on how this tool works and the input that needs to supplied, please click here >>>

How this works

Primers
You supply a list of primers in the form of a comma seperated file (CSV) from excel, but tab seperated files (TSV) are also supported. Non ATCG characters in the sequence and additional columns after primer name are ignored. Please use the following order

PRIMER_SEQUENCE1, PRIMER_NAME1
PRIMER_SEQUENCE2, PRIMER_NAME2
PRIMER_SEQUENCE3, PRIMER_NAME3

Ideally you will input your whole primer library from your lab’s primer collection. This program has been sucessfully tested with around 2500 primers in Firefox, Safari and Chrome.

DNA sequence
You supply the raw sequence without FASTA headers. Non ATCG characters are ignored. e.g.

ACGCGAGCGACGACGACGACGACGGGCAGGCAGCAGAC
GGCTATATGCTAGCTCGATACTAGCATCTACGACTACT
ACTACGACTCTAGCATCATCATCTACCGACGACGACTA
TCGCAGACGACGGACGACGCTATTATATTATGCGATCG

Melting temperature
You set the minimum melting temperature. This is simply approximated by the formula (# of A and T) x 2°C + (# of A and T) x 4°C. Please keep in mind that the actual annealing temperature will be a little bit less. Typically I use 5°C as an estimate, so if you would like an annealing of 50, please choose 55°C melting tempterature. Default melting temperatue is 55°C.

Line width
You set the line width to suit your display, depending on how many bases you can view on your screen at once. Default is 120 bp.

Find Primers
Press the “Find Primers” button to start the search. Depending on the number of primers and size of DNA this can take a few seconds. Please to not switch tabs or windows as this might interrupt the calculation.

Note, that DNA sequences and primers are not sent to my websever but remain in your browser only. You can save this webpage on your computer and reuse it offline if you like.

This script uses Papaparse, a CSV parser for JS.

Name of your primer alignment
This will be printed on the results document and might come in handy if you print this page.

Primers (Comma seperated, CSV)
Load a file
or input primer sequences directly (more than one file can be supplied at the same time):
Format: Sequence, Name (Or use universal primers from GATC, AddGene, Macrogen, IDTdna)

Sequence (Raw sequence)
Load a file or input DNA sequence directly: Additional settings
Line width:
Minimum melting temperature to be considered binding:

Please start by pressing “Find Primers” button